cwlS [2018-02-13T15:04:28.000Z]

D,L-endopeptidase, peptidoglycan hydrolase for cell separation

Locus: BSU19410

Isoelectric point: 10.44

Molecular weight: 44.07 kDa

Protein length: 414 aa

Gene length: 1242 bp

Function: cell separation

Product: D,L-endopeptidase, peptidoglycan hydrolase

Essential: no

Synonyms: yojL

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Autolysis
• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Endopeptidases

Gene

Coordinates: 2,115,425 → 2,116,669

The protein

Catalyzed reaction/ biological activity

• cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) PubMed

Protein family

• Cu-Zn superoxide dismutase family (according to Swiss-Prot)

Paralogous protein(s)

• the C-terminal D,L-endopeptidase domains of LytE, LytF, CwlS, and CwlO exhibit strong sequence similarity

Domains

• contains four N-acetylglucosamine-polymer-binding LysM domains PubMed
• C-terminal D,L-endopeptidase domain PubMed

Localization

• cell membrane (according to Swiss-Prot)
• localizes to cell septa and poles PubMed

Expression and Regulation

Operons

• Genes: cwlS
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon
  • SigH: sigma factor, PubMed, in SigH regulon

  Regulatory mechanism

  • CcpA: repression, [pubmed|], in CcpA regulon
  • Abh: repression, synergistic transcription repression with AbrB PubMed, in Abh regulon
  • AbrB: repression, synergistic transcription repression with Abh PubMed, in AbrB regulon

  Regulation

  • repressed by glucose (3-fold) (CcpA) PubMed

• Genes: cwlS-yojM
  Description: PubMed

Biological materials

Mutant

• MGNA-B424 (yojL::erm), available at the NBRP B. subtilis, Japan
• BKE19410 (ΔcwlS::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCATTCAACCTCCTAAA, downstream forward: _UP4_TAAAAATGAGTATGACAAAA
• BKK19410 (ΔcwlS::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCATTCAACCTCCTAAA, downstream forward: _UP4_TAAAAATGAGTATGACAAAA

References

Reviews

Loading

Original publications

Loading